Human Variation and Race

The effects of cold weather can be difficult to maneuver around with humans as we are not specifically designed to permanently battle that environment. Without proper protection, humans are susceptible to frost nip and frost bite, and at its most severe, can develop hypothermia if their core body temperature drops to below 94° F from its normal temperature of 98.6° F. Once body temperature hits below 85° F, you'll body will become cooler and cooler quicker resulting in death. Homeostasis is difficult to maintain in this environment, but humans have developed ways to survive the icy terrain.

One short term adaptation that human bodies use to fight cold is usually triggered as soon as you feel the effects. Shivering is a bodily reflex used to maintain homeostasis and prevent hypothermia. Muscles throughout our body begin to shake, expending energy and creating warmth. This adaptation starts at the soonest inclination of lowered body temperature and usually dissipates as soon as your core temperature regulates to normal.

One facultative adaptation that humans use against the cold is the process of vasoconstriction, which is the narrowing of blood vessels near the surface of the skin. By doing so, the body preserves body heat by slowing down blood flow, which causes the skin to cool down, but allows less heat loss. This however needs to be monitored as the colder the environment gets, the more susceptible you are to frostbite. The body does have a check for that in vasodilation, which increases warm blood flow, thus preventing frostbite. The body switches between the two for as long as it is needed.

A developmental response to cold that humans have acquired is the shapes of our bodies. One of the many factors that attribute to body shape, colder environments typically found north of the equator have necessitated the need for stouter, bulkier bodies which allow them higher heat production. Joel Allen's findings also tell us that bodies in colder environments tend to have shorter appendages in order to have less body surface area. These bodies are a long-term effect of living in the cold and do not change with the weather, they are permanent in some form for life.

Probably the biggest cultural adaptation humans developed against the cold comes from the use of clothing. For example the clothing made by the Yup'ik people of Alaska are one of the most effective cold weather clothing around. They made waterproof outerwear using the intestines of sea mammals, and used animal hide and fur to make clothes and footwear. They even used grass to make insulating socks.These inventions greatly improved their survival in the cold harsh environment of Alaska without using much or any modern technology.

It is always beneficial to study human variation caused by environmental clines. It allows us to develop a complete understanding of how our bodies react to these different environments, for both its positives and negatives. An example of this is using hypothermia as a therapeutic method for victims of cardiac arrest or acute spinal or lung injuries. Without our extensive knowledge of how cold weather affects the human body, we wouldn't be able to explore and exploit the benefits of what is usually considered a danger.

I wouldn't be able to use race to understand the adaptations as it has no correlation to these changes. Our bodies have a distinct connection with the weather and thus develop safety nets to avoid injury or death. You'll see these changes in all humans. Race has zero involvement in deciding whether or not a person can shiver to regulate homeostasis. Or whether your family develops stout stocky bodies (as we see this in both Inuit tribes and Europeans who live further away from the equator.) Race is 100% a societal construct and should not be used to study human variation. If anything, these variations are a key component to how humans see "race", which is just a categorization of visible phenotypes and stereotypical characteristics. 

The Case of the Piltdown Man

One of the best (or worst) examples of what could go wrong when bias is introduced to science, The Piltdown Man was a paleoanthropological hoax in the early 1900s orchestrated by a group of scientists in England that affected the entire scientific community for decades. On December 18, 1912, British scientist Charles Dawson claimed that a skull fragment was found and given to him in Piltdown, East Sussex four years prior. He, along with fellow paleontologist Arthur Smith Woodward went back to the site where Dawson found additional skull fragments. Upon analyzing the skull, they found that it was similar in many ways to a human skull, but also had traits shared with the chimpanzee. This lead them to believe it was new link in the evolution chain between humans and apes. It also significantly supported the theory that the large human brain was the first evolutionary step that lead to the homo sapiens. The scientific community accepted these finds as a breakthrough.

Despite initial acceptance, there were a few scientists who challenged the study due to structure of the skull. They found the skull and jaw to be mismatched, especially concerning its dentition and the existence of canine teeth with human-like molars. Eager to back up his findings, Woodward, Dawson and French paleontologist Pierre Teilhard de Chardin went back to the site and miraculously found a canine tooth that fit the jaw perfectly. Curiously, Chardin left soon after that and did not continue working on the project. Scientists continued to challenge their findings as canine teeth contradicted the existence of human-like molars, which are caused by side-to-side chewing movements; something that would have been impossible with large canines. Despite all that, scientists weren't yet concerned with the authenticity of the skull, but rather its design. The biggest proponent to Woodward's reconstruction, Arthur Keith, was merely accused of arguing with the findings as a means of promoting his own ideas on the skull.

The Piltdown Man continued to be a controversial subject throughout the years, having since been backed by the finding of a second Piltdown skull matching the first, and thus falsifying the hypothesis that a human skull and an ape jaw simply ended up in the same location. However, in 1953, after fluorine absorption dating was created, they decided to test out the skull fragments to see just how old they were. Shockingly, the discovered the skull fragments were much more recent then they imagined. These findings along with the discovery of what at the time were considered younger fossil fragments that bore less human traits prompted an investigation and the eventual exposure of the Piltdown hoax. In a recent 2016 review, it was noted that Dawson alone made all the alterations to what is now known to be an orangutan skull in order to create this supposed ancestor. It was found that the same preparation of staining, teeth filing and molding were done by the same person, of which Dawson was the only person involved in both findings.

While I mostly attribute the scale of the impact of the hoax on the level of technology and tools these scientists had available at the time, I believe these scientists were a little too focused on reputation over true science. A big reason why the Piltdown man was so readily accepted was due to the cultural and social desire from England to have the earliest known connection to man be found in their home country. Many scientists put aside their investigatory nature for their nationalism, becoming less critical and more easily supportive of the claim. Rather than trying to falsify the hypothesis, they pushed to make it reality, despite the evidence against it creeping behind them.

The process of fluorine absorption dating was a huge breakthrough for paleontology and science in general. If we still lived in a time where we couldn't date these fossils, it would've have gotten exponentially more difficult to disprove the Piltdown findings with all those present having been long gone. Aside from that, a big positive is the nature of scientists to continue to try to disprove theories that were considered unfalsifiable in the past. If we did not further test these theories, we wouldn't be able to find more information they may have missed, or as with this case, we wouldn't realize that the findings weren't reputable.

I don't believe the "human" factor can be removed from science, it's intrinsic to our curious nature. It may have its faults, but like most human traits and characteristics, the good outweighs the bad. It's these hunches and ideas that allow us to progress and gain knowledge we would have otherwise disregarded.

A big life lesson here is that in the science, your individual needs (or in this case, your nationalist needs) should never take precedence over the pursuit of the truth. One must remember that it's a positive thing to be wrong in science, as that lets you check off one route, and continue to the next. In science, as in all fields of study, you may try to trick your way into the history books, but those who write them will always figure you out eventually.

Homology & Analogy

Homologous Trait

a) Humans are the only surviving species of the Homo genus, known for their erect posture and their bipedalism. Humans have more complex brains than most animals, gifting them with improved communication and survival techniques. Dolphins are a grouping of the order Cetacea, which includes around 40 different species of dolphins. They are highly social and intelligent animals that exhibit complex behaviors such as learning, teaching and even grieving. Both humans and dolphins are known to be some of the smartest species in the world.

b) The forelimbs of humans (arms) and dolphins (fins) are an example of a homologous trait. Dolphins use their fins to help them swim and traverse through the ocean, while humans use their arms for a variety of things including grabbing and reaching for items, using tools, and defending themselves. While they serve very different functions, if you go far back enough to find their common ancestor, you'll see that the forelimb started off as one design that further evolved to fit each descendant's respective environment. Evidence that dolphin fins and human arms are homologous is in their bone anatomy. Both limbs include a humerus, an ulna, radius and carpals as well as five-digit phalanges. Though they may be structured different to meet their respective needs, the anatomy is still the same, showing us that these limbs developed from a common ancestor.

c) You would have to go way back in time to find the common ancestor between humans and dolphins as dolphins split from primates long before humans existed. But the common ancestor must have been able to utilize their forelimbs for something than just walking. Perhaps the common ancestor exhibited traits of bipedalism that would have caused it to develop differently from their hind limbs.

Analogous Trait

a) Another example that features humans is the development of the eye, as compared to a cephalopod eye found in animals such as the octopus. The octopus is a mollusk, a highly diverse phylum that features invertebrate species.

b) Cephalopods such as the octopus have a camera eye that's similar in structure to the human camera eye. While they provide the same function and even developed quite similarly, the evolution of the eye in humans was vastly different to that of the octopus. It's an analogous trait because while humans and octopodes do not share a common ancestor, the development of the camera eye was crucial to both their respective ancestors to survive. Both human and octopus eyes share a similar anatomy; they each include an iris, a retina, nerve fibers and an optic nerve. They aren't completely the same however. As an example of convergent evolution, the environment of each respective species required similar, but different needs, so the eye isn't developed exactly the same. For example, in human eyes, the nerve fibers route before the retina, which helps block light, but also creates a blind spot in our view. In octopus eyes however, the fibers route behind, causing no blind spot, giving them better vision and defense from predators.

c) You would have to go quite a long time back to find the common ancestor between cephalopods and humans, however, I would imagine that that common ancestor had a very rudimentary photoreceptor cell to be able to tell when it was in the sun, in the dark or in shade. After the split between these two species, that trait developed to further meet their respective needs.

Protein Synthesis (DNA)

GGATTACCACGCAAACGCTAGTGCCATGGGCACCTTCATATTAAAATCTATCAGGTG

Scientific Method

1) It is possible that the student does not get the recommended amount of hours of sleep at night, whether that be due to other responsibilities or a detrimental lifestyle.

2) Test:

• I would gather information first by asking when they usually goes to bed at night and if there are any reasons why they may not be getting enough sleep before class. I would then test this hypothesis by asking them to go to bed at an earlier time and get at least 8 hours of sleep before going to class the next day, as well as avoid anything that may cause them to stay up late such as drinking coffee, playing video games or going out late at night. A way to make sure that they accomplish this would be to install a sleep tracking app on their phone that analyses their sleep patterns. This would also provide further data and see if they have troubling staying asleep.
• If the student stays home, drinks only water, gets at least 8 hours of sleep the night before class and is able to stay awake, this would support my hypothesis.
• If the student followed all the guidelines and still fell asleep, this would falsify my current hypothesis and would require more research on their health and lifestyle. Or perhaps they're just not a morning person.

3) An example of an untestable, unfalsifiable explanation would be that the student is not human, but a well-nigh perfect robot clone that requires recharging about fifteens minutes after every 6 hours and your class coincides with their next recharge. 

"If you were stranded on a desert island, what two items would you take with you and why?"

Were I to be stranded on a desert island, aside from the too easy answer of "food and a boat to leave the island" I would hope to have with me a fishing rod and an ax to cut down trees and fashion my own boat out of the island. It's not as fun to answer this question when there's 100% chance of survival.